formatting and syntax

[Michael S. Robeson II]

Hi I am all still to new to PERL and I am having trouble playing with
formatting my data into a new format. So here is my problem:

I have data (DNA sequence) in a file that looks like this:

####
# Infile
####

>bob

AGTGATGCCGACG

>fred

ACGCATATCGCAT

>jon

CAGTACGATTTATC

and I need it converted to:

####
# Outfile
####
R 1 20

A G U G A T G C C G A C G - - - - - - - bob
A C G C A U A U C G C A U - - - - - - - fred
C A G U A C G A U U U A U C - - - - - - jon


The "R 1" is static and should always appear. The "20" at the top of
the new file should be a number defined by the user, that is they
should be prompted for the length they wish the sequence to be. That is
the total length of the sequence plus the added dashes could be 20 or
3000 or whatever. So, if they type 20 and there is only 10 letters in
that row then the script should add 10 dashes to bring that total up to
the 20 chosen by the user.

Note that there should be a space between all letters and dashes -
including a space at the beginning. Then there are supposed to be 7
spaces after the sequence string followed by the name as shown in the
example output file above. Also, of note is the fact that all of the
T's are changed to U's. For those of you that know biology I am not
only switching formats of the data but also changing DNA to RNA.

I hope I am explaining this clear enough, but here (see below) is as
far as I can get with the code. I just do not know how to structure the
loop/code to do this. I always have trouble with manipulating data the
way I want when it comes to a loop. I would prefer an easier to
understand code rather than an efficient code. This way I can learn the
simple stuff first and learn the short-cuts later. Thanks to anyone who
can help.

- Cheers!
- Mike

######
#!/usr/bin/perl
use warnings;
use strict;

print "Enter the path of the INFILE to be processed:\n";

# For example "rotifer.txt" or "../Desktop/Folder/rotifer.txt"

chomp (my $infile = <STDIN>);

open(INFILE, $infile)
or die "Can't open INFILE for input: $!";

print "Enter in the path of the OUTFILE:\n";

# For example "rotifer_out.txt" or "../Desktop/Folder/rotifer_out.txt"

chomp (my $outfile = <STDIN>);

open(OUTFILE, ">$outfile")
or die "Can't open OUTFILE for input: $!";

print "Enter in the LENGTH you want the sequence to be:\n";
my ( $len ) = <STDIN> =~ /(\d+)/ or die "Invalid length parameter";


print OUTFILE "R 1 $len\n\n\n\n"; # The top of the file is supposed

# type of loop or structure to follow ?????

#############

[Rob Dixon]

Michael S. Robeson II wrote:

>
> Hi I am all still to new to PERL and I am having trouble playing with
> formatting my data into a new format. So here is my problem:
>
> I have data (DNA sequence) in a file that looks like this:

[snip]

Please don't talk about interesting stuff like DNA sequences on a Perl
group. We need less distraction.

Rob

[James Edward Gray II]

On Feb 4, 2004, at 11:35 AM, Michael S. Robeson II wrote:

> Hi I am all still to new to PERL and I am having trouble playing with
> formatting my data into a new format. So here is my problem:
>
> I have data (DNA sequence) in a file that looks like this:
>
> ####
> # Infile
> ####

> >bob

> AGTGATGCCGACG

> >fred

> ACGCATATCGCAT

> >jon

> CAGTACGATTTATC
>
> and I need it converted to:
>
> ####
> # Outfile
> ####
> R 1 20
>
> A G U G A T G C C G A C G - - - - - - - bob
> A C G C A U A U C G C A U - - - - - - - fred
> C A G U A C G A U U U A U C - - - - - - jon
>
>
> The "R 1" is static and should always appear. The "20" at the top of
> the new file should be a number defined by the user, that is they
> should be prompted for the length they wish the sequence to be. That
> is the total length of the sequence plus the added dashes could be 20
> or 3000 or whatever. So, if they type 20 and there is only 10 letters
> in that row then the script should add 10 dashes to bring that total
> up to the 20 chosen by the user.
>
> Note that there should be a space between all letters and dashes -
> including a space at the beginning. Then there are supposed to be 7
> spaces after the sequence string followed by the name as shown in the
> example output file above. Also, of note is the fact that all of the
> T's are changed to U's. For those of you that know biology I am not
> only switching formats of the data but also changing DNA to RNA.
>
> I hope I am explaining this clear enough, but here (see below) is as
> far as I can get with the code. I just do not know how to structure
> the loop/code to do this. I always have trouble with manipulating data
> the way I want when it comes to a loop. I would prefer an easier to
> understand code rather than an efficient code. This way I can learn
> the simple stuff first and learn the short-cuts later. Thanks to
> anyone who can help.
>
> - Cheers!
> - Mike
>
> ######
> #!/usr/bin/perl
> use warnings;
> use strict;
>
> print "Enter the path of the INFILE to be processed:\n";
>
> # For example "rotifer.txt" or "../Desktop/Folder/rotifer.txt"
>
> chomp (my $infile = <STDIN>);
>
> open(INFILE, $infile)
> or die "Can't open INFILE for input: $!";
>
> print "Enter in the path of the OUTFILE:\n";
>
> # For example "rotifer_out.txt" or "../Desktop/Folder/rotifer_out.txt"
>
> chomp (my $outfile = <STDIN>);
>
> open(OUTFILE, ">$outfile")
> or die "Can't open OUTFILE for input: $!";
>
> print "Enter in the LENGTH you want the sequence to be:\n";
> my ( $len ) = <STDIN> =~ /(\d+)/ or die "Invalid length parameter";
>
>
> print OUTFILE "R 1 $len\n\n\n\n"; # The top of the file is supposed

my $name;
while (<INFILE>) {
chomp;
if (/^>(\w+)/) { $name = $1; }
else {
tr/T/U/; # convert Ts to Us
substr($_, $len) = '' if length($_) > $len; # shorten, if needed
$_ .= '.' x ($len - length($_)) if length($_) < $len; # lengthen, if
needed
s/\b|\B/ /g; # add spaces
print OUTFILE "$_ $name\n"; # print
}
}

Hope that helps.

James

[David]

Michael S. Robeson II wrote:

> I have data (DNA sequence) in a file that looks like this:
>
> ####
> # Infile
> ####

> >bob

> AGTGATGCCGACG

> >fred

> ACGCATATCGCAT

> >jon

> CAGTACGATTTATC
>
> and I need it converted to:
>
> ####
> # Outfile
> ####
> R 1 20
>
> A G U G A T G C C G A C G - - - - - - - bob
> A C G C A U A U C G C A U - - - - - - - fred
> C A G U A C G A U U U A U C - - - - - - jon

there are many ways of doing that. here is one:

#!/usr/bin/perl -w
use strict;

#--
#-- discard the first 3 header lines
#--
<DATA> for 1..3;

#--
#-- read each ' >'
#--
$/ = ' >';

while(<DATA>){

next unless(my($n,$s) = /(.+)\n(.+)/);

#--
#-- pad dna sequence to 20 bytes and translate T to U
#-- here, you will prompt the user to enter a number instead
#--
($s .= '-'x(20-length($s))) =~ y/T/U/;

#--
#-- put space after each character
#--
$s =~ s/./$& /g;

print "$s\t$n\n";
}

__DATA__
####
# Infile
####

>bob

AGTGATGCCGACG

>fred

ACGCATATCGCAT

>jon

CAGTACGATTTATC

__END__

prints:

A G U G A U G C C G A C G - - - - - - - bob
A C G C A U A U C G C A U - - - - - - - fred
C A G U A C G A U U U A U C - - - - - - jon

david
--
sub'_{print"@_ ";* \ = * __ ,\ & \}
sub'__{print"@_ ";* \ = * ___ ,\ & \}
sub'___{print"@_ ";* \ = * ____ ,\ & \}
sub'____{print"@_,\n"}&{_+Just}(another)->(Perl)->(Hacker)

[Jeff 'Japhy' Pinyan]

On Feb 4, Michael S. Robeson II said:

> >bob

>AGTGATGCCGACG

> >fred

>ACGCATATCGCAT

> >jon

>CAGTACGATTTATC

>R 1 20
>
> A G U G A T G C C G A C G - - - - - - - bob
> A C G C A U A U C G C A U - - - - - - - fred
> C A G U A C G A U U U A U C - - - - - - jon
>
>
>The "R 1" is static and should always appear. The "20" at the top of
>the new file should be a number defined by the user, that is they
>should be prompted for the length they wish the sequence to be. That is
>the total length of the sequence plus the added dashes could be 20 or
>3000 or whatever. So, if they type 20 and there is only 10 letters in
>that row then the script should add 10 dashes to bring that total up to
>the 20 chosen by the user.

I'll provide one way to do this:

# assuming $size has the number entered by the user

while (<FILE>) {
my ($name) = / >(.+)/; # get the line name
chomp(my $DNA = <FILE>); # get the next line (the DNA)

# add $size - length() dashes to the end of $DNA
$DNA .= "-" x ($size - length $DNA);

# print the DNA with spaces, then a tab, then the name
print join(" ", split //, $DNA), "\t$name\n";
}

--
Jeff "japhy" Pinyan [email]japhy@pobox.com[/email] [url]http://www.pobox.com/~japhy/[/url]
RPI Acacia brother #734 [url]http://www.perlmonks.org/[/url] [url]http://www.cpan.org/[/url]
<stu> what does y/// stand for? <tenderpuss> why, yansliterate of course.
[ I'm looking for programming work. If you like my work, let me know. ]

[R. Joseph Newton]

"Michael S. Robeson II" wrote:

> Hi I am all still to new to PERL and I am having trouble playing with
> formatting my data into a new format. So here is my problem:
>
> I have data (DNA sequence) in a file that looks like this:
>
> ####
> # Infile
> ####

> >bob

> AGTGATGCCGACG

> >fred

> ACGCATATCGCAT

> >jon

> CAGTACGATTTATC

Good we can see the input structure here. What jumps out at me is that the
input file comes in pairs of lines. You will want to structure your input
routine to read and handle the lines by the pair, then.

>
>
> and I need it converted to:
>
> ####
> # Outfile
> ####
> R 1 20
>
> A G U G A T G C C G A C G - - - - - - - bob
> A C G C A U A U C G C A U - - - - - - - fred
> C A G U A C G A U U U A U C - - - - - - jon

>

[snip-a picture is worth athousands woprds, and you showed us the picture
above.]

Well we have a fairly simple problem here, I'd say:

Greetings! E:\d_drive\perlStuff\giffy>perl -w
my $sequence_length = 20;
my $line = <DATA>;
chomp $line;
while ($line) {
my $sequence_tag = trim_line($line);
$line = <DATA>;
chomp $line;
my @nucleotides = split //, $line;
push @nucleotides, '_' for (1..($sequence_length - @nucleotides));
print join(' ', @nucleotides), " $sequence_tag\n";
$line = <DATA>;
chomp $line;
}

sub trim_line {
my $in_line = shift;
$in_line =~ s/^ >//;
chomp $in_line;
return $in_line;
}

__DATA__

>bob

AGTGATGCCGACG
A G T G A T G C C G A C G _ _ _ _ _ _ _ bob

>fred

ACGCATATCGCAT
A C G C A T A T C G C A T _ _ _ _ _ _ _ fred

>jon

CAGTACGATTTATC
C A G T A C G A T T T A T C _ _ _ _ _ _ jon

or, better yet...

Greetings! E:\d_drive\perlStuff\giffy>perl -w
my $sequence_length = 20;
my $line = <DATA>;
chomp $line;
while ($line) {
my $sequence_tag = trim_line($line);
$line = <DATA>;
chomp $line;
$line = print_underscore_padded($line, $sequence_length, $sequence_tag);

}


sub trim_line {
my $in_line = shift;
$in_line =~ s/^ >//;
chomp $in_line;
return $in_line;
}

sub print_underscore_padded {
my ($line, $sequence_length, $sequence_tag) = @_;
my @nucleotides = split //, $line;
push @nucleotides, '_' for (1..($sequence_length - @nucleotides));
print join(' ', @nucleotides), " $sequence_tag\n";
$line = <DATA>;
chomp $line;
return $line;
}

__DATA__

>bob

AGTGATGCCGACG
A G T G A T G C C G A C G _ _ _ _ _ _ _ bob

>fred

ACGCATATCGCAT
A C G C A T A T C G C A T _ _ _ _ _ _ _ fred

>jon

CAGTACGATTTATC
C A G T A C G A T T T A T C _ _ _ _ _ _ jon


Does that help?

Joseph

[Jeff 'Japhy' Pinyan]

On Feb 5, R. Joseph Newton said:

>my $sequence_length = 20;
>my $line = <DATA>;
>chomp $line;
>while ($line) {
> my $sequence_tag = trim_line($line);
> $line = <DATA>;
> chomp $line;
> my @nucleotides = split //, $line;
> push @nucleotides, '_' for (1..($sequence_length - @nucleotides));

I'd be in favor of:

push @nucleotides, ('_') x ($sequence_length - @nucleotides);

The 'x' operator on a list returns the list elements repeated the
specified number of times.

>__DATA__

> >bob

>AGTGATGCCGACG
>A G T G A T G C C G A C G _ _ _ _ _ _ _ bob

Ack. You're mixing the input with the output!

--
Jeff "japhy" Pinyan [email]japhy@pobox.com[/email] [url]http://www.pobox.com/~japhy/[/url]
RPI Acacia brother #734 [url]http://www.perlmonks.org/[/url] [url]http://www.cpan.org/[/url]
<stu> what does y/// stand for? <tenderpuss> why, yansliterate of course.
[ I'm looking for programming work. If you like my work, let me know. ]

[James Edward Gray II]

(redirected to Perl Beginners by James)

On Feb 11, 2004, at 10:34 AM, Michael S. Robeson II wrote:

> Hey, thanks again for the perl code.

You're welcome, but let's keep our discussion on the mailing list so we
can all help and learn.

> However, I forgot to take into account that the original input file
> can look one of two ways:

Ah, the old switcheroo. Gotcha. <laughs>

> >bob

> atcgactagcatcgatcg
> acacgtacgactagcac
>

> >fred

> actgactacgatcgaca
> acgcgcgatacggcat
>
> or (as I posted originally)
>

> >bob

> atcgactagcatcgatcgacacgtacgactagcac
>

> >fred

> actgactacgatcgacaacgcgcgatacggcat
>
> to be out put as:
>
> R 1 42
> a t c g a c t a g c a t c g a t c g a c a c g t a c g a c t a g c a c
> - - - - - - - bob
> a c t g a c t a c g a t c g a c a a c g c g c g a t a c g g c a t - -
> - - - - - - - fred

How about this time I give you the code to parse the two types of input
and you tie it in with the parts we've already figured out to get the
right output? Just shout if you run into more problems.

James

#!/usr/bin/perl

use strict;
use warnings;

local $/ = ''; # use "paragraph mode"

while (<DATA>) {
unless (s/^>(.+?)\s*\n//) { # find and remove the name
warn "Skipping unknown format: $_";
next;
}

my $name = $1; # save name
tr/\n //d; # join multi-line sequences

print "Name: $name, Sequence: $_\n"; # show off our progess
}

__DATA__

>bob

atcgactagcatcgatcg
acacgtacgactagcac

>fred

actgactacgatcgaca
acgcgcgatacggcat

>bob

atcgactagcatcgatcgacacgtacgactagcac

>fred

actgactacgatcgacaacgcgcgatacggcat